ligation independent cloning (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
ligation independent cloning
Ligation Independent Cloning, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ligation+independent+cloning/T4+DNA+Polymerase/bio_rxiv__64898__2026__05__07__723518-225-28-31
Average 99 stars, based on 4565 article reviews
Ligation Independent Cloning, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ligation+independent+cloning/T4+DNA+Polymerase/bio_rxiv__64898__2026__05__07__723518-225-28-31
Average 99 stars, based on 4565 article reviews
ligation independent cloning - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Amplification:Article Title: Legionella effector AnkX displaces the switch II region for Rab1b phosphocholination. Article Snippet: .. The AnkX1–800 (referred to as AnkX)–encoding DNA, which previously had been amplified from L. pneumophila genomic DNA (14), was cloned into a modified pSF vector (Oxford Genetics) by sequence and Clone Assay:Article Title: Legionella effector AnkX displaces the switch II region for Rab1b phosphocholination. Article Snippet: .. The AnkX1–800 (referred to as AnkX)–encoding DNA, which previously had been amplified from L. pneumophila genomic DNA (14), was cloned into a modified pSF vector (Oxford Genetics) by sequence and Article Title: Improved Methods for Deamination-Based m 6 A Detection. Article Snippet: ADARcd-YTHD422N and ADARcd-YTHmut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMVAPOBEC1-YTHmut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTHmut, APO1- YTHD422N, and APOBEC1 alone) were cloned into the PETHis6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Improved Methods for Deamination-Based m 6 A Detection Article Snippet: ADARcd-YTH D422N and ADARcd-YTH mut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMV-APOBEC1-YTH mut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTH mut , APO1-YTH D422N , and APOBEC1 alone) were cloned into the PET-His6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Neuron-recognizable characteristics of peptides recombined using a neuronal binding domain of botulinum neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a Article Title: Neuron-Recognizable Characteristics of Peptides Recombined Using A Neuronal Binding Domain of Botulinum Neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a Article Title: Oncomimetic β-catenin activity onset, duration and region defines aberrant intestinal development Article Snippet: .. In order to generate vector plasmids for stable cell line and organoid line generation, plasmid fragments were combined by traditional cloning (NEB restriction enzymes and Quick Ligase) and Modification:Article Title: Legionella effector AnkX displaces the switch II region for Rab1b phosphocholination. Article Snippet: .. The AnkX1–800 (referred to as AnkX)–encoding DNA, which previously had been amplified from L. pneumophila genomic DNA (14), was cloned into a modified pSF vector (Oxford Genetics) by sequence and Sequencing:Article Title: Legionella effector AnkX displaces the switch II region for Rab1b phosphocholination. Article Snippet: .. The AnkX1–800 (referred to as AnkX)–encoding DNA, which previously had been amplified from L. pneumophila genomic DNA (14), was cloned into a modified pSF vector (Oxford Genetics) by sequence and Ligation:Article Title: Legionella effector AnkX displaces the switch II region for Rab1b phosphocholination. Article Snippet: .. The AnkX1–800 (referred to as AnkX)–encoding DNA, which previously had been amplified from L. pneumophila genomic DNA (14), was cloned into a modified pSF vector (Oxford Genetics) by sequence and Article Title: Improved Methods for Deamination-Based m 6 A Detection. Article Snippet: ADARcd-YTHD422N and ADARcd-YTHmut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMVAPOBEC1-YTHmut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTHmut, APO1- YTHD422N, and APOBEC1 alone) were cloned into the PETHis6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Natural Variation Meets Synthetic Biology: Promiscuous Trichome Expressed Acyltransferases from Nicotiana acuminata Article Snippet: VIGS fragments targeting two different regions of NacASAT1 (sequence 5’-3’ ASAT1a, aaatccaactcgggtagaaatactcacagcacttttttataaatgtggtatgaaagtgatcaattcgtgttcattcaagccatctatcttattcctaa ctgtgaatttaagatctcttattcctctgccagatgatactcctggaaattttagttcttcccttcttgtgcctacatataatgaagaagaaatgaattt atcaagattggttagtcagctaa; ASAT1b, tgctgattttttcaaggctcgattcgattgtcccatgtctgaaatccttaaaagtcctgataaaaatgtcaaagaattagtatatcctaaggatatac catggaatgttgttacatctaatagaaagttggtcacagttcaatttaaccaatttgattgtggaggaatagctctaagtgcatgtgtatcacaca aaattggagatatgtgcacagtatccaaatttttacaag) and NacPDS (sequence 5’-3’ ggagggcaatcttatgttgaagctcaagacggtttaagtgttaaggactggatgagaaagcaaggtgtgcctgatagggtgacagatgagg tgttcattgccatgtcaaaggcacttaacttcataaaccctgacgagctttcaatgcagtgcattttgattgctttgaacagatttcttcaggagaa acatggttcaaaaatggcctttttagatggtaaccct) were designed using SGN VIGS tool ( https://vigs.solgenomics.net/ ) and the fragments were amplified using PCR adapters for ligation into pTRV2-LIC. pTRV2-LIC was digested as previously described using Pst I to generate the linearized vector ( ). .. Linearized vector and PCR fragments were combined using Article Title: Improved Methods for Deamination-Based m 6 A Detection Article Snippet: ADARcd-YTH D422N and ADARcd-YTH mut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMV-APOBEC1-YTH mut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTH mut , APO1-YTH D422N , and APOBEC1 alone) were cloned into the PET-His6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Neuron-recognizable characteristics of peptides recombined using a neuronal binding domain of botulinum neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a Article Title: Neuron-Recognizable Characteristics of Peptides Recombined Using A Neuronal Binding Domain of Botulinum Neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a Article Title: Oncomimetic β-catenin activity onset, duration and region defines aberrant intestinal development Article Snippet: .. In order to generate vector plasmids for stable cell line and organoid line generation, plasmid fragments were combined by traditional cloning (NEB restriction enzymes and Quick Ligase) and Cloning:Article Title: Legionella effector AnkX displaces the switch II region for Rab1b phosphocholination. Article Snippet: .. The AnkX1–800 (referred to as AnkX)–encoding DNA, which previously had been amplified from L. pneumophila genomic DNA (14), was cloned into a modified pSF vector (Oxford Genetics) by sequence and Article Title: Improved Methods for Deamination-Based m 6 A Detection. Article Snippet: ADARcd-YTHD422N and ADARcd-YTHmut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMVAPOBEC1-YTHmut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTHmut, APO1- YTHD422N, and APOBEC1 alone) were cloned into the PETHis6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Natural Variation Meets Synthetic Biology: Promiscuous Trichome Expressed Acyltransferases from Nicotiana acuminata Article Snippet: VIGS fragments targeting two different regions of NacASAT1 (sequence 5’-3’ ASAT1a, aaatccaactcgggtagaaatactcacagcacttttttataaatgtggtatgaaagtgatcaattcgtgttcattcaagccatctatcttattcctaa ctgtgaatttaagatctcttattcctctgccagatgatactcctggaaattttagttcttcccttcttgtgcctacatataatgaagaagaaatgaattt atcaagattggttagtcagctaa; ASAT1b, tgctgattttttcaaggctcgattcgattgtcccatgtctgaaatccttaaaagtcctgataaaaatgtcaaagaattagtatatcctaaggatatac catggaatgttgttacatctaatagaaagttggtcacagttcaatttaaccaatttgattgtggaggaatagctctaagtgcatgtgtatcacaca aaattggagatatgtgcacagtatccaaatttttacaag) and NacPDS (sequence 5’-3’ ggagggcaatcttatgttgaagctcaagacggtttaagtgttaaggactggatgagaaagcaaggtgtgcctgatagggtgacagatgagg tgttcattgccatgtcaaaggcacttaacttcataaaccctgacgagctttcaatgcagtgcattttgattgctttgaacagatttcttcaggagaa acatggttcaaaaatggcctttttagatggtaaccct) were designed using SGN VIGS tool ( https://vigs.solgenomics.net/ ) and the fragments were amplified using PCR adapters for ligation into pTRV2-LIC. pTRV2-LIC was digested as previously described using Pst I to generate the linearized vector ( ). .. Linearized vector and PCR fragments were combined using Article Title: Improved Methods for Deamination-Based m 6 A Detection Article Snippet: ADARcd-YTH D422N and ADARcd-YTH mut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMV-APOBEC1-YTH mut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTH mut , APO1-YTH D422N , and APOBEC1 alone) were cloned into the PET-His6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Neuron-recognizable characteristics of peptides recombined using a neuronal binding domain of botulinum neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a Article Title: Neuron-Recognizable Characteristics of Peptides Recombined Using A Neuronal Binding Domain of Botulinum Neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a Article Title: Oncomimetic β-catenin activity onset, duration and region defines aberrant intestinal development Article Snippet: .. In order to generate vector plasmids for stable cell line and organoid line generation, plasmid fragments were combined by traditional cloning (NEB restriction enzymes and Quick Ligase) and In Vitro:Article Title: Improved Methods for Deamination-Based m 6 A Detection. Article Snippet: ADARcd-YTHD422N and ADARcd-YTHmut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMVAPOBEC1-YTHmut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTHmut, APO1- YTHD422N, and APOBEC1 alone) were cloned into the PETHis6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Improved Methods for Deamination-Based m 6 A Detection Article Snippet: ADARcd-YTH D422N and ADARcd-YTH mut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMV-APOBEC1-YTH mut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTH mut , APO1-YTH D422N , and APOBEC1 alone) were cloned into the PET-His6-MBP-TEV LIC plasmid (Addgene #29656) by Plasmid Preparation:Article Title: Improved Methods for Deamination-Based m 6 A Detection. Article Snippet: ADARcd-YTHD422N and ADARcd-YTHmut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMVAPOBEC1-YTHmut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTHmut, APO1- YTHD422N, and APOBEC1 alone) were cloned into the PETHis6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Natural Variation Meets Synthetic Biology: Promiscuous Trichome Expressed Acyltransferases from Nicotiana acuminata Article Snippet: VIGS fragments targeting two different regions of NacASAT1 (sequence 5’-3’ ASAT1a, aaatccaactcgggtagaaatactcacagcacttttttataaatgtggtatgaaagtgatcaattcgtgttcattcaagccatctatcttattcctaa ctgtgaatttaagatctcttattcctctgccagatgatactcctggaaattttagttcttcccttcttgtgcctacatataatgaagaagaaatgaattt atcaagattggttagtcagctaa; ASAT1b, tgctgattttttcaaggctcgattcgattgtcccatgtctgaaatccttaaaagtcctgataaaaatgtcaaagaattagtatatcctaaggatatac catggaatgttgttacatctaatagaaagttggtcacagttcaatttaaccaatttgattgtggaggaatagctctaagtgcatgtgtatcacaca aaattggagatatgtgcacagtatccaaatttttacaag) and NacPDS (sequence 5’-3’ ggagggcaatcttatgttgaagctcaagacggtttaagtgttaaggactggatgagaaagcaaggtgtgcctgatagggtgacagatgagg tgttcattgccatgtcaaaggcacttaacttcataaaccctgacgagctttcaatgcagtgcattttgattgctttgaacagatttcttcaggagaa acatggttcaaaaatggcctttttagatggtaaccct) were designed using SGN VIGS tool ( https://vigs.solgenomics.net/ ) and the fragments were amplified using PCR adapters for ligation into pTRV2-LIC. pTRV2-LIC was digested as previously described using Pst I to generate the linearized vector ( ). .. Linearized vector and PCR fragments were combined using Article Title: Improved Methods for Deamination-Based m 6 A Detection Article Snippet: ADARcd-YTH D422N and ADARcd-YTH mut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMV-APOBEC1-YTH mut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTH mut , APO1-YTH D422N , and APOBEC1 alone) were cloned into the PET-His6-MBP-TEV LIC plasmid (Addgene #29656) by Article Title: Oncomimetic β-catenin activity onset, duration and region defines aberrant intestinal development Article Snippet: .. In order to generate vector plasmids for stable cell line and organoid line generation, plasmid fragments were combined by traditional cloning (NEB restriction enzymes and Quick Ligase) and Polymerase Chain Reaction:Article Title: Natural Variation Meets Synthetic Biology: Promiscuous Trichome Expressed Acyltransferases from Nicotiana acuminata Article Snippet: VIGS fragments targeting two different regions of NacASAT1 (sequence 5’-3’ ASAT1a, aaatccaactcgggtagaaatactcacagcacttttttataaatgtggtatgaaagtgatcaattcgtgttcattcaagccatctatcttattcctaa ctgtgaatttaagatctcttattcctctgccagatgatactcctggaaattttagttcttcccttcttgtgcctacatataatgaagaagaaatgaattt atcaagattggttagtcagctaa; ASAT1b, tgctgattttttcaaggctcgattcgattgtcccatgtctgaaatccttaaaagtcctgataaaaatgtcaaagaattagtatatcctaaggatatac catggaatgttgttacatctaatagaaagttggtcacagttcaatttaaccaatttgattgtggaggaatagctctaagtgcatgtgtatcacaca aaattggagatatgtgcacagtatccaaatttttacaag) and NacPDS (sequence 5’-3’ ggagggcaatcttatgttgaagctcaagacggtttaagtgttaaggactggatgagaaagcaaggtgtgcctgatagggtgacagatgagg tgttcattgccatgtcaaaggcacttaacttcataaaccctgacgagctttcaatgcagtgcattttgattgctttgaacagatttcttcaggagaa acatggttcaaaaatggcctttttagatggtaaccct) were designed using SGN VIGS tool ( https://vigs.solgenomics.net/ ) and the fragments were amplified using PCR adapters for ligation into pTRV2-LIC. pTRV2-LIC was digested as previously described using Pst I to generate the linearized vector ( ). .. Linearized vector and PCR fragments were combined using Positron Emission Tomography:Article Title: Improved Methods for Deamination-Based m 6 A Detection Article Snippet: ADARcd-YTH D422N and ADARcd-YTH mut plasmids were generated by replacing APOBEC1 from the pCMV-APOBEC1-YTH and pCMV-APOBEC1-YTH mut plasmids (Addgene #131636 and #131637) with ADARcd containing a hyperactivating E488Q mutation (Addgene #139686) using Gibson Assembly (NEB). .. In vitro DART-seq proteins (APO1-YTH, APO1-YTH mut , APO1-YTH D422N , and APOBEC1 alone) were cloned into the PET-His6-MBP-TEV LIC plasmid (Addgene #29656) by Mutagenesis:Article Title: Neuron-recognizable characteristics of peptides recombined using a neuronal binding domain of botulinum neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a Article Title: Neuron-Recognizable Characteristics of Peptides Recombined Using A Neuronal Binding Domain of Botulinum Neurotoxin Article Snippet: .. Deoxyribose nucleic acid (DNA) sequences having > and ≤ 60 base pairs (bps) were cloned using a other:Article Title: Expanding Polycyclic Tetramate Macrolactam (PoTeM) Core Structure Diversity by Chemo‐Enzymatic Synthesis and Bioengineering Article Snippet: Stable Transfection:Article Title: Oncomimetic β-catenin activity onset, duration and region defines aberrant intestinal development Article Snippet: .. In order to generate vector plasmids for stable cell line and organoid line generation, plasmid fragments were combined by traditional cloning (NEB restriction enzymes and Quick Ligase) and |